WO2001074870A1 - Nouveau polypeptide, alpha-galactosidase humaine a-11, et polynucleotide codant pour ce polypeptide - Google Patents

Nouveau polypeptide, alpha-galactosidase humaine a-11, et polynucleotide codant pour ce polypeptide Download PDF

Info

Publication number
WO2001074870A1
WO2001074870A1 PCT/CN2001/000212 CN0100212W WO0174870A1 WO 2001074870 A1 WO2001074870 A1 WO 2001074870A1 CN 0100212 W CN0100212 W CN 0100212W WO 0174870 A1 WO0174870 A1 WO 0174870A1
Authority
WO
WIPO (PCT)
Prior art keywords
polypeptide
galactosidase
polynucleotide
sequence
human
Prior art date
Application number
PCT/CN2001/000212
Other languages
English (en)
Chinese (zh)
Inventor
Yumin Mao
Yi Xie
Original Assignee
Biowindow Gene Development Inc. Shanghai
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Biowindow Gene Development Inc. Shanghai filed Critical Biowindow Gene Development Inc. Shanghai
Priority to AU44050/01A priority Critical patent/AU4405001A/en
Publication of WO2001074870A1 publication Critical patent/WO2001074870A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
    • C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
    • C12N9/2465—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1) acting on alpha-galactose-glycoside bonds, e.g. alpha-galactosidase (3.2.1.22)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention belongs to the field of biotechnology. Specifically, the present invention describes a new polypeptide, human alpha pha-galactosidase A-11, and a polyglycolic acid sequence encoding the polypeptide. The invention also relates to a preparation method and application of the polynucleotide and polypeptide. Background technique
  • Alpha-galactosidase A is a lysosomal enzyme that catalyzes the hydrolysis of various glycolipids containing alpha-galactosidase binding sites in the body. It is a 45-kDa N-glycosylated protein that is located on the long arm of the X chromosome. The lysosomal enzyme is involved in regulating the metabolism of various related glycolipids in the body, and its mutation or abnormal expression will lead to abnormal metabolism of lipids, that is, the accumulation of related glycolipids in tissues, which will cause various related metabolic disorders. disease.
  • lysosomal enzyme-related diseases there are a variety of lysosomal enzyme-related diseases in the body, and these diseases are mostly hereditary. It has been found that there are 30 different lysosomal diseases that have a greater impact on the human body, such as: family black Mongolian idiots , Acyl sphingosine hexatriosidase deficiency diseases, etc. Among them, acylsphingosine triglucosidase deficiency disease is a kind of lysosomal disease caused by the loss of lysosomal enzyme ⁇ -galactosidase A, which is a metabolic disorder associated with congenital X chromosome. Disease [Topa loglu A. L, Ashl ey GA et al., 1999, Mol Med, 5: 806-811].
  • a-galactosidase A from human. This enzyme is similar to a-galactosidase A from other known sources.
  • the N-terminus of its protein composition also contains a The site of interaction with the substrate glycolipid protein, and catalyzes the hydrolysis reaction of various glycolipids in the body.
  • the mutation or abnormal expression of this enzyme will cause the accumulation of various substrates such as glycosphingolipids and glycolipids in the cell cytoplasm and vascular endothelial tissue, and then cause various diseases caused by vascular disorders of the heart and kidney. Ischemia, infarction and necrosis of related tissues [F., Ohta M. et al., 1998, Glycob io logy, 8: 329-339].
  • ⁇ -galactosidase A acts as a lysosomal enzyme in the body to catalyze the hydrolysis of various glycolipids.
  • the mutation or abnormal expression of this protein will lead to the aggregation of the glycolipid protein protein tissues. And then cause a variety of related metabolic disorders and lysosomal enzyme genetic diseases.
  • This protein is usually closely related to the occurrence of metabolic disorders in related tissues, X-chromosome-related congenital diseases such as acylsphingosine glycosidase deficiency diseases and some lysosomal diseases.
  • enzyme replacement therapy can be used to diagnose and treat diseases caused by this type of enzyme deficiency, which also helps us diagnose and treat Provide evidence for such diseases.
  • the expression profile of the polypeptide of the present invention is very similar to the expression profile of human alpha-galactosidase A, so their functions may also be similar.
  • the present invention is named human alpha-galactosidase A-11.
  • the human alpha-galactosidase A-11 protein plays an important role in regulating important functions of the body such as cell division and embryonic development, and it is believed that a large number of proteins are involved in these regulatory processes, so identification in the art has been required. More human alpha-galactosidase A-11 proteins involved in these processes, and in particular the amino acid sequence of this protein was identified.
  • the isolation of the newcomer a lpha-galactosidase A-11 protein encoding gene also provides a basis for research to determine the role of this protein in health and disease states. This protein may form the basis for the development of diagnostic and / or therapeutic agents for the disease, so it is important to isolate its coding DNA. Disclosure of invention
  • Another object of the invention is to provide a polynucleotide encoding the polypeptide.
  • Another object of the present invention is to provide a recombinant vector containing a polynucleotide encoding human alpha-galactosidase A-11.
  • Another object of the present invention is to provide a method for producing human a pha-galactosidase A-11.
  • Another object of the present invention is to provide antibodies to the polypeptide-human a lpha-galactosidase A-11 of the present invention.
  • Another object of the present invention is to provide mimic compounds, antagonists, agonists, and inhibitors of a human alp-galactosidase A-II against the polypeptide of the present invention.
  • Another object of the present invention is to provide a method for diagnosing and treating diseases associated with abnormality of human alpha-galactosidase A-11.
  • the invention relates to an isolated polypeptide, which is of human origin, and comprises: a polypeptide having the amino acid sequence of SEQ ID No. 2 or a conservative variant, a biologically active fragment or a derivative thereof.
  • the polypeptide is a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the invention also relates to an isolated polynucleotide comprising a nucleotide sequence or a variant thereof selected from the group consisting of:
  • sequence of the polynucleotide is one selected from the group consisting of: (a) a sequence having positions 183-476 in SEQ ID NO: 1; and (b) a sequence having positions 1-888 in SEQ ID NO: 1 Sequence of bits.
  • the present invention further relates to a vector, particularly an expression vector, containing the polynucleotide of the present invention; a host cell genetically engineered with the vector, including a transformed, transduced or transfected host cell; Host cell and method of preparing the polypeptide of the present invention by recovering the expression product.
  • the invention also relates to an antibody capable of specifically binding to a polypeptide of the invention.
  • the invention also relates to a method for screening compounds that mimic, activate, antagonize or inhibit the activity of human alpha-galactosidase A-11 protein, which comprises utilizing the polypeptide of the invention.
  • the invention also relates to compounds obtained by this method.
  • the present invention also relates to a method for detecting a disease or disease susceptibility associated with abnormal expression of human al pha-galactosidase A-11 protein in vitro, which comprises detecting the polypeptide or a polynucleotide sequence encoding the same in a biological sample. Mutations, or the amount or biological activity of a polypeptide of the invention in a biological sample.
  • the invention also relates to a pharmaceutical composition
  • a pharmaceutical composition comprising a polypeptide of the invention or a mimetic thereof, an activator, an antagonist or an inhibitor, and a pharmaceutically acceptable carrier.
  • the present invention also relates to the preparation of the polypeptide and / or polynucleotide of the present invention for the treatment of acylsphingosine triglycosidase deficiency diseases, lysosomal diseases, cardiovascular diseases, various tumors, and disorders of growth and development, Use of inflammation, immune disease, blood disease, HIV infection or other diseases caused by abnormal expression of human alpha-galactosidase A-11.
  • Nucleic acid sequence refers to an oligonucleotide, a nucleotide or a polynucleotide and a fragment or part thereof, and may also refer to a genome or a synthetic DM or RNA, they can be single-stranded or double-stranded, representing the sense or antisense strand.
  • amino acid sequence refers to an oligopeptide, peptide, polypeptide or protein sequence and fragments or portions thereof.
  • amino acid sequence in the present invention relates to the amino acid sequence of a naturally occurring protein molecule
  • polypeptide or “protein” does not mean to limit the amino acid sequence to a complete natural amino acid related to the protein molecule .
  • a protein or polynucleotide “variant” refers to an amino acid sequence having one or more amino acids or nucleotide changes, or a polynucleotide sequence encoding it. The changes may include deletions, insertions or substitutions of amino acids or nucleotides in the amino acid sequence or nucleotide sequence.
  • Variants may have "conservative" changes in which the substituted amino acid has a structural or chemical property similar to the original amino acid, such as replacing isoleucine with leucine. Variants can also have non-conservative changes, such as replacing glycine with tryptophan.
  • “Deletion” refers to the deletion of one or more amino acids or nucleotides in an amino acid sequence or nucleotide sequence.
  • Insertion refers to an alteration in the amino acid sequence or nucleotide sequence that results in an increase in one or more amino acids or nucleotides compared to a naturally occurring molecule.
  • Replacement refers to the replacement of one or more amino acids or nucleotides with different amino acids or nucleotides.
  • Bioactivity refers to a protein that has the structure, regulation, or biochemical function of a natural molecule.
  • immunologically active refers to the ability of natural, recombinant or synthetic proteins and fragments thereof to induce a specific immune response in appropriate animals or cells and to bind to specific antibodies.
  • An "agonist” refers to a molecule that, when combined with human alpha-galactosidase A-11, causes a change in the protein to regulate the activity of the protein.
  • Agonists may include proteins, nucleic acids, carbohydrates, or any other molecule that binds human alpha-galactosidase A-11.
  • Antagonist refers to a biological activity or immunity that can block or regulate human al pha-galactosidase A-11 when combined with human al pha-galactosidase A-11.
  • Chemically active molecules may include proteins, nucleic acids, carbohydrates, or any other molecule that can bind to human a pha-galactosidase A-11.
  • Regular refers to a change in the function of human alpha-galactosidase A-11, including an increase or decrease in protein activity, a change in binding properties, and any other organism of human alpha-galactosidase A-11 Changes in nature, function, or immunity.
  • substantially pure ' means substantially free of other proteins, lipids, sugars or other substances with which it is naturally associated.
  • Those skilled in the art can purify human alpha-galactosidase A- using standard protein purification techniques. ll. Basically pure human alpha-galactosidase A-11 can produce a single main band on a non-reducing polyacrylamide gel. The purity of human a lpha-galactosidase A-11 polypeptide can be used in the amino acid sequence Analysis.
  • Complementary refers to the natural binding of polynucleotides by base-pairing under conditions of acceptable salt concentration and temperature.
  • sequence C-T-G-A
  • complementary sequence G-A-C-T.
  • the complementarity between two single-stranded molecules may be partial or complete.
  • the degree of complementarity between nucleic acid strands has a significant effect on the efficiency and strength of hybridization between nucleic acid strands.
  • “Homology” refers to the degree of complementarity and can be partially homologous or completely homologous.
  • Partial homology A partially complementary sequence that at least partially inhibits the hybridization of a fully complementary sequence to a target nucleic acid. The inhibition of such hybridization can be detected by performing hybridization (Southern blotting or Northern blotting, etc.) under conditions of reduced stringency. Substantially homologous sequences or hybridization probes can compete and inhibit the binding of completely homologous sequences to the target sequence under conditions of reduced stringency. This does not mean that the conditions of reduced stringency allow non-specific binding, because the conditions of reduced stringency require that the two sequences bind to each other as a specific or selective interaction.
  • Percent identity refers to the percentage of sequences that are the same or similar in a comparison of two or more amino acid or nucleic acid sequences. The percent identity can be determined electronically, such as through the MEGALIGN program (Lasergene sof tware package, DNASTAR, Inc., Madi son Wis.). The MEGALIGN program can compare two or more sequences according to different methods such as the Cluster method (Higgins, D. G. and P. M. Sharp (1988) Gene 73: 237-244). The Cluster method arranges groups of sequences into clusters by checking the distance between all pairs. The clusters are then assigned in pairs or groups.
  • sequence A and sequence B The percent identity between two amino acid sequences such as sequence A and sequence B is calculated by the following formula: The number of matching residues between sequence A and sequence X 100 The number of residues in sequence A-the number of spacer residues in sequence A Number of interval residues in a sequence B
  • the percent identity between nucleic acid sequences can also be determined by the Clus ter method or by methods known in the art such as Jotun Hein (Hein J., (1990) Methods in emzurao logy 183: 625-645).
  • Similarity refers to the degree of identical or conservative substitutions of amino acid residues at corresponding positions in the alignment of amino acid sequences.
  • Amino acids used for conservative substitutions for example, negatively charged amino acids may include aspartic acid and glutamic acid; positively charged amino acids may include lysine and arginine; having an uncharged head group is Similar hydrophilic amino acids may include leucine, isoleucine and valine; glycine and alanine; asparagine and glutamine; serine and threonine; phenylalanine and tyrosine.
  • Antisense refers to a nucleotide sequence that is complementary to a particular DM or RNA sequence.
  • Antisense strand refers to a nucleic acid strand that is complementary to a “sense strand.”
  • Derivative refers to a chemical modification of HFP or a nucleic acid encoding it. This chemical modification may be a substitution of a hydrogen atom with a fluorenyl, acyl or amino group. Nucleic acid derivatives can encode polypeptides that retain the main biological properties of natural molecules.
  • Antibody refers to a complete antibody molecule and its fragments, such as Fa, F (ab ') 2 and Fv, which can specifically bind to the antigenic determinant of human alpha-galactosidase A-11.
  • Humanized antibody means that the amino acid sequence of a non-antigen-binding region is replaced with a human antibody Antibodies that are similar but still retain the original binding activity.
  • isolated refers to the removal of a substance from its original environment (for example, its natural environment if it is naturally occurring).
  • a naturally-occurring polynucleotide or polypeptide is not isolated when it is present in a living thing, but the same polynucleotide or polypeptide is separated from some or all of the substances that coexist with it in the natural system.
  • Such a polynucleotide may be part of a certain vector, or such a polynucleotide or polypeptide may be part of a certain composition. Since the carrier or composition is not part of its natural environment, they are still isolated.
  • isolated refers to the separation of a substance from its original environment (if it is a natural substance, the original environment is the natural environment).
  • polynucleotides and polypeptides in a natural state in a living cell are not isolated and purified, but the same polynucleotides or polypeptides are separated and purified if they are separated from other substances in the natural state .
  • isolated human alpha-galactosidase A-11 means that human alpha-galactosidase A-11 is substantially free of other proteins, lipids, carbohydrates, or others naturally associated with it. substance. Those skilled in the art can purify human a-pha-galactosidase A-11 using standard protein purification techniques. Essentially pure peptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of human a lpha-galactosidase A-11 polypeptide can be analyzed by amino acid sequence.
  • the present invention provides a new polypeptide, human alpha-galactosidase A-11, which is basically composed of the amino acid sequence shown in SEQ ID NO: 2.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, and preferably a recombinant polypeptide.
  • the polypeptides of the present invention can be naturally purified products, or chemically synthesized products, or can be produced from prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects, and mammalian cells) using recombinant techniques. Depending on the host used in the recombinant production protocol, the polypeptide of the invention may be glycosylated, or it may be non-glycosylated. Polypeptides of the invention may also include or exclude initial methionine residues.
  • the invention also includes fragments, derivatives and analogs of human alpha-galactosidase A-11.
  • fragment refers to a polypeptide that substantially maintains the same biological function or activity of the human alpha-galactosidase A-11 of the present invention.
  • a fragment, derivative or analog of the polypeptide of the present invention may be: (I) a kind in which one or more amino acid residues are substituted with conservative or non-conservative amino acid residues (preferably conservative amino acid residues), and the substitution
  • the amino acid may or may not be encoded by a genetic codon; or ( ⁇ ) such a type in which one or more amino acid residues are substituted with other groups to include a substituent; or (III) such One in which the mature polypeptide is fused to another compound (such as a compound that extends the half-life of the polypeptide, such as polyethylene glycol); or ( ⁇ ) such that an additional amino acid sequence is fused to the mature polypeptide
  • the resulting polypeptide sequence (such as a leader sequence or a secreted sequence or a sequence used to purify the polypeptide or a protease sequence)
  • the present invention provides an isolated nucleic acid (polynucleotide), which basically consists of a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 2.
  • the polynucleotide sequence of the present invention includes the nucleotide sequence of SEQ ID NO: 1.
  • the polynucleotide of the present invention is found from a cDNA library of human fetal brain tissue. It contains a polynucleotide sequence of 888 bases in length and its open reading frame 183-476 encodes 97 amino acids.
  • this polypeptide has a similar expression profile to human alpha-galactosidase A, and it can be inferred that the human alpha-galactosidase A-11 has human alpha-galactosidase A Similar functionality.
  • the polynucleotide of the present invention may be in the form of DM or RNA.
  • DNA forms include cDNA, genomic DNA, or synthetic DNA.
  • DNA can be single-stranded or double-stranded.
  • DNA can be coding or non-coding.
  • the coding region sequence encoding a mature polypeptide may be the same as the coding region sequence shown in SEQ ID NO: 1 or a degenerate variant.
  • a "degenerate variant" refers to a nucleic acid sequence encoding a protein or polypeptide having SEQ ID NO: 2 in the present invention, but which differs from the coding region sequence shown in SEQ ID NO: 1.
  • the polynucleotide encoding the mature polypeptide of SEQ ID NO: 2 includes: only the coding sequence of the mature polypeptide; the coding sequence of the mature polypeptide and various additional coding sequences; the coding sequence of the mature polypeptide (and optional additional coding sequences); Coding sequence.
  • polynucleotide encoding a polypeptide refers to a polynucleotide comprising the polypeptide and a polynucleotide comprising additional coding and / or non-coding sequences.
  • the invention also relates to variants of the polynucleotides described above, which encode polypeptides or fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the invention.
  • Variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants.
  • an allelic variant is an alternative form of a polynucleotide that may be a substitution, deletion, or insertion of one or more nucleotides, but does not substantially change the function of the polypeptide it encodes .
  • the invention also relates to a polynucleotide that hybridizes to the sequence described above (having at least 50%, preferably 70% identity between the two sequences).
  • the invention particularly relates to polynucleotides that can hybridize to the polynucleotides of the invention under stringent conditions.
  • “strict conditions” means: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2xSSC, 0.1% SDS, 6 (TC; or (2) Add denaturants during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Fi co ll, 42 ° C, etc .; or (3) Hybridization occurs only when the identity between the two sequences is at least 95%, and more preferably 97%.
  • the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 2.
  • nucleic acid fragments that hybridize to the sequences described above.
  • a "nucleic acid fragment” contains at least 10 nucleotides in length, preferably at least 20-30 nucleotides, more preferably at least 50-60 nucleotides, most preferably at least 100 nucleotides. Nucleotides or more. Nucleic acid fragments can also be used in nucleic acid amplification techniques such as PCR to identify and / or isolate polynucleotides encoding human alpha-galactosidase A-11.
  • polypeptides and polynucleotides in the present invention are preferably provided in an isolated form and are more preferably purified to homogeneity.
  • the specific polynucleotide sequence of the present invention encoding human a-pha-galactosidase A-11 can be obtained by various methods.
  • polynucleotides are isolated using hybridization techniques well known in the art. These techniques include, but are not limited to: 1) hybridization of probes to genomic or CDM libraries to detect homologous polynucleotide sequences, and 2) antibody screening of expression libraries to detect cloned polynucleosides with common structural characteristics Acid fragments.
  • the DNA fragment sequence of the present invention can also be obtained by the following methods: 1) isolating the double-stranded DNA sequence from the genomic DNA; 2) chemically synthesizing the DM sequence to obtain the double-stranded DNA of the polypeptide.
  • genomic DNA is the least commonly used. Direct chemical synthesis of DNA sequences is often the method of choice. The more commonly used method is the isolation of cDNA sequences.
  • the standard method for isolating the cDNA of interest is to isolate mRNA from donor cells that overexpress the gene and perform reverse transcription to form a plasmid or phage cDNA library.
  • the construction of cDNA libraries is also a common method (Sambrook, et al., Molecula Cloning, A Labora tory Manua, Collspring Harbor Laboratory. New York, 1989).
  • Commercially available cDM libraries are also available, such as different cDNA libraries from Clontech. When polymerase reaction technology is used in combination, even very small expression products can be cloned.
  • genes of the present invention can be screened from these cDM libraries by conventional methods. These methods include (but are not limited to): (l) DNA-DM or DNA-RNA hybridization; (2) the presence or absence of marker gene functions; (3) determination of human al-pha-galactosidase A-11 transcripts (4) Detecting the protein product of gene expression by immunological techniques or measuring biological activity. The above methods can be used singly or in combination.
  • the probe used for hybridization is homologous to any part of the polynucleotide of the present invention, and its length is at least 10 nucleotides, preferably at least 30 nucleotides, more preferably At least 50 nucleotides, preferably at least 100 nucleotides.
  • the length of the probe is usually within 2000 nucleotides, preferably within 1000 nucleotides.
  • the probe used herein is generally a DNA sequence chemically synthesized based on the gene sequence information of the present invention.
  • the genes or fragments of the present invention can of course be used as probes.
  • DM probes can be labeled with radioisotopes, luciferin, or enzymes (such as alkaline phosphatase).
  • immunological techniques such as Western blotting, radioimmunoprecipitation, and enzyme-linked immunosorbent assay (ELISA) can be used to detect the protein product of human alpha-galactosidase A-11 gene expression.
  • ELISA enzyme-linked immunosorbent assay
  • a method using PCR technology to amplify DNA / RM (Sa iki, et al. Sc ience 1985; 230: 1350-1354) is preferably used to obtain the gene of the present invention.
  • the RACE method RACE-Rapid Amplification of cDNA Ends
  • the primers used for PCR can be appropriately based on the polynucleotide sequence information of the present invention disclosed herein. Select and synthesize using conventional methods.
  • the amplified DNA / RNA fragments can be isolated and purified by conventional methods such as by gel electrophoresis.
  • polynucleotide sequence of the gene of the present invention or various DNA fragments and the like obtained as described above can be determined by a conventional method such as dideoxy chain termination method (Sanger et al. PNAS, 1977, 74: 5463-5467). Such polynucleotide sequences can also be determined using commercial sequencing kits and the like. In order to obtain the full-length cDNA sequence, the sequencing must be repeated. Sometimes it is necessary to determine the cDM sequences of multiple clones in order to splice into full-length cDM sequences.
  • the present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell that is genetically engineered using the vector of the present invention or directly using a human alpha-galactosidase A-11 coding sequence, and that the present invention is produced by recombinant technology A method of inventing the polypeptide.
  • a polynucleotide sequence encoding human alpha-galactosidase A-11 can be inserted into a vector to constitute a recombinant vector containing the polynucleotide of the present invention.
  • vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses, or other vectors well known in the art.
  • Vectors suitable for use in the present invention include, but are not limited to: T7 promoter-based expression vectors (Rosenberg, et al.
  • any plasmid and vector can be used to construct a recombinant expression vector.
  • An important feature of expression vectors is that they usually contain an origin of replication, a promoter, a marker gene, and translational regulatory elements.
  • DM sequence can be operably linked to an appropriate promoter in an expression vector to guide mRNA synthesis.
  • promoters are: lac or trp promoter of E.
  • the expression vector also includes a ribosome binding site and a transcription terminator for translation initiation. Insertion of enhancer sequences into the vector will enhance its transcription in higher eukaryotic cells. Enhancers are cis-acting factors expressed by DM, usually about 10 to 300 base pairs, which act on promoters to enhance gene transcription. Illustrative examples include SV40 enhancers of 100 to 270 base pairs on the late side of the origin of replication, polyoma enhancers on the late side of the origin of replication, and adenovirus enhancers. .
  • the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance, and green for eukaryotic cell culture.
  • GFP fluorescent protein
  • tetracycline or ampicillin resistance for E. coli.
  • a polynucleotide encoding human alpha-galactosidase A-11 or a recombinant vector containing the polynucleotide can be transformed or transduced into a host cell to constitute a genetic engineering containing the polynucleotide or the recombinant vector.
  • Host cells refers to a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell.
  • Escherichia coli, Streptomyces bacterial cells such as Salmonella typhimurium
  • fungal cells such as yeast
  • plant cells insect cells
  • fly S2 or Sf 9 animal cells
  • animal cells such as CH0, COS or Bowes melanoma cells.
  • Transformation of a host cell with a DNA sequence described in the present invention or a recombinant vector containing the DNA sequence can be performed using conventional techniques well known to those skilled in the art.
  • the host is a prokaryote such as E. coli
  • competent cells capable of DNA uptake can be in the exponential growth phase were harvested, treated with (1 2 method used in the step are well known in the art. Alternatively, it is a MgCl 2.
  • transformation can also be performed by electroporation.
  • the following DNA transfection methods can be used: calcium phosphate co-precipitation method, or conventional mechanical methods such as microinjection, electroporation, and liposome packaging Wait.
  • the polynucleotide sequence of the present invention can be used to express or produce recombinant human alpha-galactosidase A-11 (Science, 1984; 224: 1431). Generally there are the following steps:
  • the medium used in the culture can be selected from various Conventional medium. Culture is performed under conditions suitable for host cell growth. After the host cells have grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.
  • a suitable method such as temperature conversion or chemical induction
  • the recombinant polypeptide may be coated in a cell, expressed on a cell membrane, or secreted outside the cell.
  • recombinant proteins can be separated and purified by various separation methods using their physical, chemical, and other properties. These methods are well known to those skilled in the art. These methods include, but are not limited to: conventional renaturation, protein precipitant treatment (salting out method), centrifugation, osmosis, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, Ion exchange chromatography, high performance liquid chromatography (HPLC), and various other liquid chromatography techniques and combinations of these methods.
  • conventional renaturation protein precipitant treatment (salting out method), centrifugation, osmosis, ultrasonic treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, Ion exchange chromatography, high performance liquid chromatography (HPLC), and
  • Fig. 1 is a comparison diagram of gene chip expression profiles of the present inventors a lpha-galactosidase A-11 and human alpha-galactosidase A.
  • the upper graph is a graph of the expression profile of human alpha-galactosidase A-11, and the lower sequence is the graph of the expression profile of human alpha-galactosidase A-11.
  • FIG. 2 is a polyacrylamide gel electrophoresis diagram (SDS-PAGE) of isolated human alpha-galactosidase A-11.
  • lKDa is the molecular weight of the protein.
  • the arrow indicates the isolated protein band. The best way to implement the invention
  • Total human fetal brain RNA was extracted by one-step method with guanidine isothiocyanate / phenol / chloroform.
  • Quik mRNA Isolat ion Kit product of Qiegene was used to isolate poly (A) m from total RNA. 2ug poly (A) mRNA is reverse transcribed to form cDNA.
  • the Smart cDNA cloning kit purchased from Clontech was used to insert the cDNA fragment into the multiple cloning site of the pBSK (+) vector (Clontech) to transform DH5 ⁇ , and the bacteria formed a cDNA library.
  • CDNA was synthesized using fetal brain total RNA as a template and ol igo-dT as a primer for reverse transcription reaction. After purification with Qiagene's kit, PCR amplification was performed with the following primers:
  • Pr imerl 5,-CAGAAGTCAAAGATCAAGGTGCCA -3, (SEQ ID NO: 3)
  • Pr imer2 5'- AATTACTCTTTATTCCAATATTAT -3, (SEQ ID NO: 4)
  • Pr imerl is a forward sequence located at the 5th end of SEQ ID NO: 1, starting at lbp;
  • Pr imer2 is the 3'-end reverse sequence in SEQ ID NO: 1.
  • Amplification conditions 50 mmol / L KCl, 10 mmol / L Tris s in a reaction volume of 50 ⁇ 1-
  • Total RM was extracted in one step [Anal. Biochem 1987, 162, 156-159].
  • This method involves acid guanidinium thiocyanate phenol-chloroform extraction. 4M guanidinium isothiocyanate-25mM sodium citrate, 0.2M Sodium acetate (pH 4.0) was used to homogenize the tissue, 1 volume of phenol and 1/5 volume of chloroform-isoamyl alcohol (49: 1) were added, and the mixture was centrifuged. The aqueous phase layer was aspirated and isopropyl alcohol ( 0.8 volume) and centrifuging the mixture to obtain an RNA pellet. The resulting RNA pellet was washed with 70% ethanol, dried and dissolved in water.
  • Primer3 5,-CCCCATATGATGTCTGGCTGCGCTGTTATTTAT -3, (Seq ID No: 5)
  • Primer4 5'- CATGGATCCTCACACTCCTAGTCCACCTTCATG -3 '.
  • the 5' ends of these two primers contain Ndel and BamHI restriction sites, respectively. , followeded by the coding sequences of the 5 'and 3' ends of the gene of interest, respectively.
  • the Ndel and BamHI restriction sites correspond to the selectivity on the expression vector plasmid pET-28b (+) (Novagen, Cat. No. 69865.3). Endonuclease site.
  • PCR was performed using the pBS-0290c04 plasmid containing the full-length target gene as a template.
  • the PCR reaction conditions were as follows: a total volume of 50 ⁇ l containing 10 pg of pBS- 0290c04 plasmid, primers Primer 3 and Primer-4, and 'J was lOpmol, Advantage polymerase Mix (Clontech) 1 ⁇ 1. Cycle parameters: 94 ° C 20s, 60 ° C 30s, 68 ° C 2 min, a total of 25 cycles. Ndel and BamHI were used to double-digest the amplified product and plasmid pET-28 (+), respectively, and large fragments were recovered and ligated with T4 ligase.
  • the ligation product was transformed into E. coli DH5a by the calcium chloride method. After being cultured overnight on LB plates containing kanamycin (final concentration 3 () g / ml), positive clones were screened by colony PCR method and sequenced. A positive clone (pET-0290C04) with the correct sequence was selected, and the recombinant plasmid was transformed into E. coli BL21 (DE3) plySs (product of Novagen) using the calcium chloride method.
  • the host bacteria BL21 (pET-0290c04) was cultured at 37 ° C to the logarithmic growth phase, IPTG was added to the final concentration lramol / L, and continued Incubate for 5 hours. The bacteria were collected by centrifugation, and the supernatant was collected by centrifugation. The supernatant was collected by centrifugation. The affinity chromatography column His. Bind Quick Cartridge (product of Novagen) was used to obtain 6 histidine (6His-Tag). The purified protein of interest was human alpha-galactosidase A-11.
  • a peptide synthesizer (product of PE company) was used to synthesize the following human alpha-galactosidase A-11-specific peptides:
  • NH2-Met-Ser-Gly-Cys-Ala-Val-Ile-Tyr-Trp-Ile-Gln-Ser-Lys-Arg-Gly-C00H SEQ ID NO: 7
  • the polypeptide is coupled with hemocyanin and bovine serum albumin to form a complex, respectively.
  • hemocyanin and bovine serum albumin For methods, see: Avrameas, et al. Immunochemi stry, 1969; 6: 43. Rabbits were immunized with 4 mg of the hemocyanin polypeptide complex plus complete Freund's adjuvant, and 15 days later, the hemocyanin polypeptide complex plus incomplete Freund's adjuvant was used to boost immunity once.
  • Suitable oligonucleotide fragments are selected from the polynucleotides of the present invention for use as hybrids.
  • Cross probes are used in a variety of ways.
  • the probes can be used with genomic or cDNA libraries of normal or pathological tissue from different sources. Hybridize to identify whether it contains the polynucleotide sequence of the present invention and detect the homologous polynucleotide sequence, further use the probe to detect the polynucleotide sequence of the present invention or its homologous polynucleotide sequence in normal tissue Or whether the expression in pathological tissue cells is abnormal.
  • the purpose of this embodiment is to select a suitable oligonucleotide fragment from the polynucleotide SEQ ID NO: 1 of the present invention as a hybridization probe, and to identify whether some tissues contain the polynucleoside of the present invention by a filter hybridization method.
  • Filter hybridization methods include dot blotting, Southern imprinting, Northern blotting, and copying methods. They all use the same steps to immobilize the polynucleotide sample to be tested on the filter.
  • the sample-immobilized filter is first pre-hybridized with a probe-free hybridization buffer to saturate the non-specific binding site of the sample on the filter with the carrier and the synthesized polymer.
  • the pre-hybridization solution is then replaced with a hybridization buffer containing labeled probes and incubated to hybridize the probes to the target nucleic acid.
  • the unhybridized probes are removed by a series of membrane washing steps.
  • This embodiment uses higher-intensity washing conditions (such as lower salt concentration and higher temperature), so that the hybridization background is reduced and only strong specific signals are retained.
  • the probes used in this embodiment include two types: the first type of probes are oligonucleotide fragments that are completely the same as or complementary to the polynucleotide SEQ ID NO: 1 of the present invention; the second type of probes are partially related to the present invention
  • the polynucleotide SEQ ID NO: 1 is the same or complementary oligonucleotide fragment.
  • the dot blot method is used to fix the sample on the filter membrane. Under the high-intensity washing conditions, the first type of probe and the sample have the strongest hybridization specificity and are retained.
  • oligonucleotide fragments from the polynucleotide SEQ ID NO: 1 of the present invention for use as hybridization probes should follow the following principles and several aspects to be considered: 1.
  • the preferred range of probe size is 18-50 nucleotides;
  • Those that meet the above conditions can be used as primary selection probes, and then further computer sequence analysis, including the primary selection probe and its source sequence region (ie, SEQ ID NO: 1) and other known genomic sequences and their complementary regions For homology comparison, if the homology with the non-target molecule region is greater than 85% or there are more than 15 consecutive bases, the primary probe should generally not be used;
  • ⁇ ⁇ -Probe 1 which belongs to the first type of probe, is completely homologous or complementary to the gene fragment of SEQ ID NO: 1 (41Nt) : ⁇
  • Probe 1 which belongs to the second type of probe, is equivalent to the replacement mutant sequence of the gene fragment of SEQ ID NO: 1 or its complementary fragment (41Nt):
  • step 8-13 are only used when contamination must be removed, otherwise step 14 can be performed directly.
  • NC membranes nitrocellulose membranes
  • Two NC membranes are required for each probe, so that they can be used in the following experimental steps.
  • the film was washed with high-strength conditions and strength conditions, respectively.
  • Gene microarrays or DNA microarrays are new technologies currently being developed by many national laboratories and large pharmaceutical companies. It refers to the orderly and high-density arrangement of a large number of target gene fragments on glass, The data is compared and analyzed on a carrier such as silicon using fluorescence detection and computer software to achieve the purpose of fast, efficient, and high-throughput analysis of biological information.
  • the polynucleotide of the present invention can be used as target DNA for gene chip technology for high-throughput research of new gene functions; search for and screen new tissue-specific genes, especially new genes related to diseases such as tumors; diagnosis of diseases such as hereditary diseases .
  • the specific method steps have been reported in the literature. For example, see the literature DeRi si, JL, Lyer, V. & Brown, PO-(1997) Sc ience 278, 680-686. And the documents Hel le, RA, Schema, M Chai, A., Shalom, D., (1997) PNAS 94: 2150-2155.
  • a total of 4,000 polynucleotide sequences of various full-length cDNAs are used as target DNA, including the polynucleotide of the present invention. They were respectively amplified by PCR. After purification, the concentration of the amplified product was adjusted to about 500 ng / ul, and spotted on a glass medium with a Cartesian 7500 spotter (purchased from Cartesian Company, USA). The distance between them is 280 ⁇ ⁇ . The spotted slides were hydrated, dried, and cross-linked in a UV cross-linking instrument. After elution, the DNA was fixed on the glass slide to prepare a chip. The specific method steps have been variously reported in the literature. The post-spotting processing steps of this embodiment are:
  • Probe labeling was extracted from human mixed tissues and specific tissues (or stimulated cell lines) in one step, and purified with Ol igotex mRNA Midi Ki t (purchased from QiaGe'n).
  • Hybridization was performed in a Solut ion (purchased from TeleChem) hybridization solution for 16 hours, and then washed with a washing solution (lx SSC, 0.2 SDS) at room temperature, and then scanned with a ScanArray 3000 scanner (purchased by General Scanning, USA).
  • the scanned image Imagene software (Biodiscovery Company, USA) was used for data analysis and processing to calculate the Cy3 / Cy5. Ratio of each point. . :
  • the above specific tissues are thymus, testis, muscle, spleen, lung, skin, thyroid, liver, PMA + Ecv304 cell line, PMA-Ecv304 cell line, non-starved L02 cell line, Arsenic stimulated the L02 cell line and prostate tissue for 1 hour. Based on these 13 Cy3 / Cy5 ratios, a bar graph is drawn. (figure 1 ) . It can be seen from the figure that the expression profiles of human alpha-galactosidase A-11 and human alpha-galactosidase A according to the present invention are very similar. Industrial applicability
  • polypeptide of the present invention and the antagonists, agonists and inhibitors of the polypeptide can be directly used in the treatment of diseases, for example, it can treat malignant tumors, adrenal deficiency, skin diseases, various inflammations, HIV infections and immune diseases.
  • Alpha-galactosidase A is a lysosomal enzyme that catalyzes the hydrolysis of various glycolipids containing alpha-galactosidase binding sites in the body. It participates in regulating the metabolism of various related glycolipids, and its mutation or abnormal expression will lead to abnormal metabolism of lipids, causing the accumulation of various substrates such as glycosphingolipids and glycolipids in the cell cytoplasm and vascular endothelial tissue, In turn, it causes ischemia, infarction and necrosis of various related tissues caused by cardiac and visceral vascular disorders.
  • lysosomal enzyme-related diseases such as: Among the family melancholic idiots and acylsphingosine trisidase-deficient diseases, the acylsphingosine trisidase-deficient diseases are caused by the loss of the lysosomal enzyme ⁇ -galactosidase A. Lysosomal disease, which is a congenital X chromosome-related metabolic disorder.
  • the expression profile of the polypeptide of the present invention is consistent with the expression profile of human ⁇ -galactosidase A, and both have similar biological functions. It is mainly used as a lysosomal enzyme to catalyze the hydrolysis of various glycolipids containing ⁇ -galactosidase binding sites in the body. Its abnormal expression is usually associated with lipid metabolism abnormalities and glycosphingolipids in the body. Accumulation of various substrates such as glycosides and glycolipids in the cell cytoplasm and ii endothelial tissue, and then cause various diseases of the heart and kidney vascular disorders. It also specifically causes the deficiency of acylsphingosine hexosidase Type disease. '
  • human alpha-galactosidase A-11 of the present invention will produce various diseases, especially acylsphingosine hexanosidase deficiency diseases, lysosomal diseases, cardiovascular diseases, various Tumors, growth disorders, inflammation, immune diseases, these diseases include but are not limited to:
  • Lysosomal disease familial melancholic idiot, acylsphingosine glycosidase deficiency disease, type II glycogen storage disease
  • Cardiovascular diseases myocardial infarction, angina pectoris, renal infarction, glomerular necrosis
  • Tumors of various tissues stomach cancer, liver cancer, lung cancer, esophageal cancer, breast cancer, leukemia, lymphoma, thyroid tumor, uterine fibroids, neuroblastoma, astrocytoma, ependymoma, glioblastoma, nerve Fibroma, colon cancer, melanoma, bladder cancer, uterine cancer, endometrial cancer, colon cancer, thymic tumor, nasopharyngeal cancer, laryngeal cancer, tracheal tumor, fibroid, fibrosarcoma, lipoma, liposarcoma
  • Growth and development disorders mental retardation, brain development disorders, skin, fat, and muscular dysplasia, bone and joint dysplasia, various metabolic defects, stunting, dwarfism, Cushing's syndrome Sexual retardation
  • Inflammation chronic active hepatitis, sarcoidosis, polymyositis, chronic rhinitis, chronic gastritis, cerebrospinal multiple sclerosis, glomerulonephritis, myocarditis, cardiomyopathy, atherosclerosis, gastric ulcer, cervicitis, Various infectious inflammations
  • Immune diseases systemic lupus erythematosus, rheumatoid arthritis, bronchial asthma, urticaria, atopic dermatitis, myocarditis after infection, scleroderma, myasthenia gravis, Guillain-Barre syndrome, general variable Immunodeficiency disease, primary B lymphocyte immunodeficiency disease, acquired immunodeficiency syndrome
  • the abnormal expression of human a lpha-galactosidase A-11 in the present invention will also produce certain hereditary, hematological diseases and the like.
  • polypeptides of the present invention can be directly used in the treatment of diseases, for example, can treat various diseases, especially acylsphingosine hexaglucosidase deficiency diseases, lysosomal diseases, Cardiovascular diseases, various tumors, disorders of growth and development, inflammation, immune diseases, certain hereditary, hematological diseases, etc.
  • the invention also provides methods for screening compounds to identify agents that increase (agonist) or suppress (antagonist) human alpha l-galactosidase A-11.
  • Agonists enhance biological functions such as human alpha-galactosidase A-11 to stimulate cell proliferation, while antagonists prevent and treat disorders related to excessive cell proliferation, such as various cancers.
  • mammalian cells or membrane preparations expressing human alpha-galactosidase A-II can be cultured with labeled human alpha-galactosidase A-11 in the presence of a drug. The ability of the drug to increase or block this interaction is then determined.
  • Antagonists of human alpha-galactosidase A-11 include sieves, antibodies, compounds, receptor deletions, and the like. Antagonists of human alpha-galactosidase A-11 can bind to human alpha-galactosidase A-11 and eliminate its function, or inhibit the production of the polypeptide, or with the active site of the polypeptide Dot binding prevents the polypeptide from functioning biologically.
  • human alpha l-galactosidase A-11 When screening compounds as antagonists, human alpha l-galactosidase A-11 can be added to the bioanalytical assay, and by measuring the compound between human alpha l-galactosidase A-11 'and its receptor The effects of interactions determine whether a compound is an antagonist. Receptor deletions and analogs that act as antagonists can be screened in the same manner as described above for screening compounds. Polypeptide molecules capable of binding to human alpha-galactosidase A-11 can be obtained by screening a random peptide library composed of various possible combinations of amino acids bound to a solid phase. When screening, human a-pha-galactosidase A-11 molecules should generally be labeled.
  • the present invention provides a method for producing antibodies using polypeptides, and fragments, derivatives, analogs or cells thereof as antigens. These antibodies can be poly'clonal or monoclonal antibodies.
  • the invention also provides antibodies against human alpha-galactosidase A-11 epitopes. These antibodies include (but are not limited to): polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, Fab fragments, and fragments produced by Fab expression libraries.
  • Polyclonal antibodies can be produced by injecting human alpha-galactosidase A-11 directly into immunized animals (such as rabbits, mice, rats, etc.).
  • immunized animals such as rabbits, mice, rats, etc.
  • a variety of adjuvants can be used to enhance the immune response, including but not Limited to Freund's adjuvant and the like.
  • Techniques for preparing monoclonal antibodies to human alpha-galactosidase A-11 include, but are not limited to, hybridoma technology (Kohler and Mi is te in. Nature, 1975, 256: 495-497), triple tumor technology, human beta -Cell hybridoma technology, EBV-hybridoma technology, etc.
  • Chimeric antibodies that bind human constant and non-human variable regions can be produced using existing techniques (Morri son et al, PNAS, 1985, 81: 6851). 0 Existing techniques for producing single-chain antibodies (US Pat No. 4946778) can also be used to produce single chain antibodies against human alpha-galactosidase A-11. Antibodies against human alpha-galactosidase A-11 can be used in immunohistochemical techniques to detect human alpha-galactosidase Al l in biopsy specimens. .
  • Monoclonal antibodies that bind to human alpha-galactosidase A-11 can also be labeled with radioisotopes and injected into the body to track their location and distribution.
  • This radiolabeled antibody can be used as a non-invasive diagnostic method to locate tumor cells and determine whether there is metastasis.
  • Antibodies can also be used to design immunotoxins that target a particular part of the body.
  • human a lpha-galactosidase A-11 high affinity monoclonal antibody can covalently bind to bacterial or plant toxins (such as diphtheria toxin, ricin, ormosine, etc.).
  • a common method is to attack the amino group of an antibody with a thiol cross-linking agent such as SPDP and bind the toxin to the antibody through the exchange of disulfide bonds.
  • This' hybrid antibody can be used to kill human alpha l-galactosidase.
  • A-11 positive cells ⁇
  • the antibodies of the present invention can be used to treat or prevent diseases associated with human alpha-galactosidase A-11. Administration of appropriate doses of antibodies can stimulate or block the production or activity of human alpha-galactosidase A-11. .
  • the invention also relates to a diagnostic test method for quantitative and localized detection of human alpha-galactosidase A-11 levels.
  • tests are well known in the art and include FISH assays and radioimmunoassays.
  • the level of human alpha-galactosidase A-11 detected in the test can be used to explain the importance of human alpha-galactosidase A-11 in various diseases and to diagnose human alpha-galactose Diseases where glycosidase A-11 works.
  • polypeptide of the present invention can also be used for peptide mapping analysis.
  • the polypeptide can be specifically cleaved by physical, chemical or enzymatic analysis, and subjected to one-dimensional or two-dimensional or three-dimensional gel electrophoresis analysis, and more preferably mass spectrometry analysis.
  • Polynucleotides encoding human alpha-galactosidase A-11 can also be used for a variety of therapeutic purposes.
  • Gene therapy technology can be used to treat abnormal cell proliferation, development or metabolism caused by the non-expression or abnormal / inactive expression of human alpha-galactosidase A-II.
  • Recombinant gene therapy vectors (such as viral vectors) can be designed to express mutated human alpha-galactosidase A-11 to inhibit endogenous human alpha-galactosidase A-11 activity.
  • a mutated human alpha-galactosidase A-11 may be shortened human alpha-galactosidase A-11, which lacks a signaling domain, although it can bind to downstream substrates, but Lack of signaling activity. Therefore, the recombinant gene therapy vector can be used for treating diseases caused by abnormal expression or activity of human alpha-galactosidase A-11.
  • Expression vectors derived from viruses such as retrovirus, adenovirus, adenovirus-associated virus, herpes simplex disease, parvovirus, etc. can be used to transfer a polynucleotide encoding human alpha-galactosidase A-11 into cells .
  • Methods for introducing a polynucleotide into a tissue or cell include: injecting the polynucleotide directly into a tissue in vivo; or introducing the polynucleotide into a cell via a vector (such as a virus, phage, or plasmid) in vitro, and transferring the cell ⁇ into the body and so on.
  • a vector such as a virus, phage, or plasmid
  • Human a lpha-galactosidase A-11R NA oligonucleotides (including antisense NA ⁇ P DNA) and ribozymes are also within the scope of the present invention.
  • a ribozyme is an enzyme-like NA molecule that specifically breaks down specific NAs. Its mechanism of action is that copper is a ribozyme molecule that specifically hybridizes to a complementary target NA for endonucleation.
  • Antisense NA ⁇ P DNA and ribozymes can be obtained using any existing N-Wave DNA synthesis technology. For example, solid-phase phosphoramidite chemical synthesis to synthesize oligonucleotides has been widely used.
  • Antisense NA molecules can be obtained by in vitro or in vivo transcription of a DM sequence encoding the NA. This DM sequence has been integrated downstream of the M polymerase promoter of the vector. In order to increase the stability of nucleic acid molecules, it can be modified in a variety of ways, such as increasing the sequence length on both sides, and the linkage between ribonucleosides using phosphate thioester or peptide bonds instead of phosphodiester bonds.
  • a polynucleotide encoding human alpha-galactosidase A-11 can be used to interact with human alpha-galactosidase
  • a polynucleotide encoding human alpha-galactosidase A-11 can be used to detect the expression of human alpha-galactosidase A-11 or human alpha-galactosidase A-11 in a disease state Abnormal expression.
  • a DNA sequence encoding human alpha-galactosidase A-11 can be used to hybridize biopsy specimens to determine the expression of human alpha-galactosidase A-11.
  • Hybridization techniques include Southern blotting, Northern blotting, in situ hybridization, and so on. These techniques and methods are publicly known and mature, and related kits are commercially available.
  • a part or all of the polynucleotides of the present invention can be used as probes to be fixed on a micro array or a DNA chip (also called a "gene chip") for analyzing differential expression analysis and gene diagnosis of genes in tissues.
  • Human alp-galactosidase A-11 specific primers were used to perform NA polymerase chain reaction (T-PC in vitro amplification can also detect human alp-galactosidase A-11 transcription products.
  • Detection of mutations in the human alpha-galactosidase A-11 gene can also be used to diagnose human alpha-galactosidase A-11-related diseases.
  • Human a lpha-galactosidase A-11 mutations include point mutations, translocations, deletions, recombinations, and any other abnormalities compared to the normal wild-type human alpha-galactosidase A-11 DNA sequence. Mutations can be detected using well-known techniques such as Southern blotting, DNA sequence analysis, PC and in situ hybridization. In addition, mutations may affect protein expression. Therefore, Northern blotting and Western blotting can be used to indirectly determine whether a gene is mutated.
  • sequences of the invention are also valuable for chromosome identification. This sequence will be specific to someone The chromosome is in a specific location and can be crossed with it. Currently, specific sites for each gene on the chromosome need to be identified. Currently, only a few chromosome markers based on actual sequence data (repeating polymorphisms) are available for labeling chromosome positions. According to the present invention, in order to associate these sequences with disease-related genes, an important first step is to locate these DNA sequences on a chromosome.
  • PCR primers (preferably 15-35bp) are prepared based on cDNA, and the sequences can be located on chromosomes. These primers were then used for PCR screening of somatic hybrid cells containing individual human chromosomes. Only those heterozygous cells containing human genes corresponding to the primers will produce increased fragments.
  • Somatic cell hybridization with PCR is a quick and easy way to map DNA to specific chromosomes.
  • oligonucleotide primers of the present invention in a similar manner, a set of fragments from a specific chromosome or a large number of genomic clones can be used to achieve sublocalization.
  • Other similar strategies that can be used for chromosomal localization include in situ hybridization, chromosome pre-screening with labeled flow sorting, and pre-selection of hybridization to construct chromosome-specific cDNA libraries.
  • Fluorescent in situ hybridization of cDNA clones with metaphase chromosomes allows precise chromosomal localization in one step.
  • FISH Fluorescent in situ hybridization
  • the physical location of the sequence on the chromosome can be correlated with the genetic map data. These data can be found in, for example, V. Mckusick, Mendelian Inheritance in Man (available online with Johns Hopkins University Welch Medical Library). Linkage analysis can then be used to determine the relationship between genes and diseases that have been mapped to chromosomal regions.
  • the difference in cDNA or genomic sequence between the affected and unaffected individuals needs to be determined. If a mutation is observed in some or all diseased individuals and the mutation is not observed in any normal individuals, the mutation may be the cause of the disease. Comparing affected and unaffected individuals usually involves first looking for structural changes in chromosomes, such as deletions or translocations that are visible at the chromosomal level or detectable with cDNA sequence-based PCR. According to the resolution capabilities of current physical mapping and gene mapping technology, the cDNA accurately mapped to the chromosomal region associated with the disease can be one of 50 to 500 potentially pathogenic genes (assuming 1 megabase mapping resolution Capacity and each 20kb corresponds to a gene).
  • the polypeptides, polynucleotides and mimetics, agonists, antagonists and inhibitors of the present invention can be used in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier can be water, glucose, ethanol, salts, buffers, glycerol, and combinations thereof.
  • the composition comprises a safe and effective amount of the polypeptide or antagonist, and carriers and excipients which do not affect the effect of the drug. These compositions can be used as drugs for the treatment of diseases.
  • the present invention also provides a kit or kit containing one or more containers, the containers containing one or more An ingredient of the pharmaceutical composition of the present invention.
  • the containers containing one or more An ingredient of the pharmaceutical composition of the present invention.
  • there may be instructional instructions given by government agencies that manufacture, use, or sell pharmaceuticals or biological products, which reminders authorize them to be administered to humans by government agencies that manufacture, use, or sell them.
  • the polypeptides of the invention can be used in combination with other therapeutic compounds.
  • the pharmaceutical composition can be administered in a convenient manner, such as by topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal route of administration.
  • Human a lpha-galactosidase A-11 is administered in an amount effective to treat and / or prevent a specific indication.
  • the amount and range of human alpha l-galactosidase A-11 administered to a patient will depend on many factors, such as the mode of administration, the health conditions of the person to be treated, and the judgment of the diagnostician.

Abstract

L'invention concerne un nouveau polypeptide, une alpha-galactosidase humaine A-11, et un polynucléotide codant pour ce polypeptide ainsi qu'un procédé d'obtention de ce polypeptide par des techniques recombinantes d'ADN. L'invention concerne en outre les applications de ce polypeptide dans le traitement de maladies, notamment des maladies liées à une déficience de l'acyl-sphingosine triglycosidase, des maladies lysosomiales, de l'angiocardiopathie, des tumeurs malignes, des troubles du développement et de la croissance, d'inflammations, de maladies immunitaires, de l'hémopathie et de l'infection par VIH. L'invention concerne aussi l'antagoniste agissant contre le polypeptide et son action thérapeutique ainsi que les applications de ce polynucléotide codant pour l'alpha-galactosidase humaine A-11.
PCT/CN2001/000212 2000-03-07 2001-02-26 Nouveau polypeptide, alpha-galactosidase humaine a-11, et polynucleotide codant pour ce polypeptide WO2001074870A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU44050/01A AU4405001A (en) 2000-03-07 2001-02-26 A novel polypeptide-human alpha-galactosidase a-11 and the polynucleotide encoding said polypeptide

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN00111924A CN1312383A (zh) 2000-03-07 2000-03-07 一种新的多肽——人alpha－半乳糖苷酶A－11和编码这种多肽的多核苷酸
CN00111924.9 2000-03-07

Publications (1)

Publication Number Publication Date
WO2001074870A1 true WO2001074870A1 (fr) 2001-10-11

Family

ID=4581820

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2001/000212 WO2001074870A1 (fr) 2000-03-07 2001-02-26 Nouveau polypeptide, alpha-galactosidase humaine a-11, et polynucleotide codant pour ce polypeptide

Country Status (3)

Country Link
CN (1) CN1312383A (fr)
AU (1) AU4405001A (fr)
WO (1) WO2001074870A1 (fr)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104131094A (zh) * 2014-07-25 2014-11-05 封志纯 用于溶酶体病基因筛查的引物组合物及试剂盒

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1994012628A1 (fr) * 1992-11-30 1994-06-09 The Mount Sinai School Of Medicine Of The City University Of New York Clonage et expression d'alpha-galactosidase a biologiquement active
US5356804A (en) * 1990-10-24 1994-10-18 Mount Sinai School Of Medicine Of The City Of New York Cloning and expression of biologically active human α-galactosidase A

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5356804A (en) * 1990-10-24 1994-10-18 Mount Sinai School Of Medicine Of The City Of New York Cloning and expression of biologically active human α-galactosidase A
WO1994012628A1 (fr) * 1992-11-30 1994-06-09 The Mount Sinai School Of Medicine Of The City University Of New York Clonage et expression d'alpha-galactosidase a biologiquement active

Also Published As

Publication number Publication date
AU4405001A (en) 2001-10-15
CN1312383A (zh) 2001-09-12

Similar Documents

Publication Publication Date Title
WO2001072786A1 (fr) Nouveau polypeptide, facteur d'inhibition tumorale 63, et polynucleotide codant pour ce polypeptide
WO2001074870A1 (fr) Nouveau polypeptide, alpha-galactosidase humaine a-11, et polynucleotide codant pour ce polypeptide
WO2001046240A1 (fr) Nouveau polypeptide, mariner transposase 19 humaine, et polynucleotide codant pour ce polypeptide
WO2001074869A1 (fr) Nouveau polypeptide, proteine humaine de choc thermique 15, et polynucleotide codant pour ce polypeptide
WO2001083538A1 (fr) Nouveau polypeptide, proteine humaine 36 du gene k-ras, et polynucleotide codant pour ce polypeptide
WO2001092326A1 (fr) Nouveau polypeptide, phosphatase acide 13, et polynucleotide codant ce polypeptide
WO2001090376A1 (fr) Nouveau polypeptide, triose phosphate isomerase humaine 11, et polynucleotide codant ce polypeptide
WO2001071003A1 (fr) Nouveau polypeptide, serine protease humaine 8, et polynucleotide codant pour ce polypeptide
WO2001094371A1 (fr) Nouveau polypeptide, proteine ribosomale humaine s4-10, et polynucleotide codant ce polypeptide
WO2001088158A1 (fr) Nouveau polypeptide, triose phosphate isomerase humaine 10, et polynucleotide codant pour ce polypeptide
WO2001075117A1 (fr) Nouveau polypeptide, tyrosinase humaine 12, et polynucleotide codant pour ce polypeptide
WO2001087972A1 (fr) Nouveau polypeptide, proteine dpc4 humaine 9 du facteur d'inhibition de la croissance tumorale, et polynucleotide codant ce polypeptide
WO2001075101A1 (fr) Nouveau polypeptide, proteine humaine de regulation de la transcription 8, et polynucleotide codant pour ce polypeptide
WO2001072801A1 (fr) Nouveau polypeptide, proteine ribosomale humaine s11 12, et polynucleotide codant pour ce polypeptide
WO2001071001A1 (fr) Nouveau polypeptide, tyrosinase humaine 15, et polynucleotide codant pour ce polypeptide
WO2001081395A1 (fr) Nouveau polypeptide, adn topo-isomerase i-15, et polynucleotide codant pour ce polypeptide
WO2001079430A2 (fr) Nouveau polypeptide, serine protease humaine 9, et polynucleotide codant pour ce polypeptide
WO2001070792A1 (fr) Nouveau polypeptide, tyrosinase humaine 12, et polynucleotide codant pour ce polypeptide
WO2001074894A1 (fr) Nouveau polypeptide, proteine humaine de regulation 12 de la proteine phosphorylase, et polynucleotide codant pour ce polypeptide
WO2001083682A2 (fr) Nouveau polypeptide, proteine pax humaine 11.6, et polynucleotide codant pour ce polypeptide
WO2001090171A1 (fr) Nouveau polypeptide, proteine humaine ribosomale sii 12, et polynucleotide codant ce polypeptide
WO2001075037A2 (fr) Nouveau polypeptide, dihydroorotase humaine 40, et polynucleotide codant pour ce polypeptide
WO2001078755A2 (fr) Nouveau polypeptide, proteine humaine de mutation 9 de l'ataxie-telangiectasie, et polynucleotide codant pour ce polypeptide
WO2001072792A1 (fr) Nouveau polypeptide, proteine humaine 13 analogue a l'ubiquitine, et polynucleotide codant pour ce polypeptide
WO2001055400A1 (fr) Nouveau polypeptide, site 90 actif de la famille rho des enzymes gtp, et polynucleotide codant pour ce polypeptide

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP