CN102382863A - Method for improving exocytosis capacity of engineering bacteria fatty acid - Google Patents

Abstract

The invention provides a method for improving an exocytosis capacity of engineering bacteria fatty acid. And the invention comprises the method for regulating a relevant gene and protein level of fatty acid metabolism, and improving the exocytosis capacity of the free fatty acid.

Description

A kind of method that improves engineering bacteria lipid acid exocytosis ability

Technical field

The present invention relates to a kind of method that improves engineering bacteria lipid acid exocytosis ability, the outer free fatty acid content of engineering mycetocyte is increased,, directly be used for the method that lipid acid is produced so that simplify the grease extraction process.

Background technology

Lipid acid is a kind of important hardware and software platform compound, is widely used in fields such as chemical industry, makeup, food, Medicines and Health Product, particularly as the application of glyceride stock source in production of biodiesel.Lipid acid can make through chemical synthesis through petroleum products; But exhaustion day by day along with petroleum resources; With the attention of the world to ecotope and environment protection, from animal-plant oil, food and beverage waste oil and grease, extract lipid acid in recent years, become the main source that lipid acid is produced at present.But these glyceride stocks receive the restriction of factors such as season, region, and raw material is difficult to collect and transportation, and production cost high (accounting for the 70%-85% of total cost of production) has seriously restricted the industrialization process of lipid acid.

Microbial oil is of a great variety, and raw materials for production are abundant, and from microbial oil, extract lipid acid, do not receive effects limit such as season, region, and therefore, utilizing mikrobe to prepare lipid acid has become this area research focus.Mostly the microbial oil that uses at present is oleaginous yeast and little algae etc., for example, and Wynn et al, Microbiology, 2001; Chisti Y, Biotechnology Advances, 2007, but these natural oleaginous microorganisms exist that growth cycle is long, genetic background is complicated, be difficult to regulation and control, and lipid acid all is to exist with total fat form in the born of the same parents mostly, and a small amount of the secretion to born of the same parents only arranged.Obtain lipid acid and must pass through sample pre-treatments, extraction, a series of complicacies such as concise, extraction refining process consuming time, and this process can produce a large amount of trade effluents, serious environment pollution.

Intestinal bacteria are clear because of having genetic background, are easy to engineering regulation and control, but high density fermentation, and advantages such as fast growth have become the desirable recipient bacterium of microorganism catalysis synthesis of chemicals and fuel.Colibacillary fatty acid metabolism route map is seen accompanying drawing 1.Existing report, engineering colon bacillus capable of using is produced lipid acid, for example, Steen et al, 2010, Nature; Liu et al, 2010, Metabolic Engineering, and can utilize that stalk etc. is low-cost, renewable physical resources, can develop engineering bacteria with business potential.But these lipid acid still are present in the cell, fail fundamentally to solve lipid acid extraction separation problem.Early-stage Study has been reported through regulation and control fatty acid metabolism genes involved (Nunn et al., 1986, J Biol Chem; Reyes et al., 2005, Science; Kampf et al., 2006, J Biol Chem; Wu et al., 2006, Proc Natl Acad Sci), obtained to produce born of the same parents' engineering bacteria of free fatty acidies outward, but the outer free fatty acid content lower (Liu et al., 2010, Metabolic Engineering) of born of the same parents.

The lipid acid exocytosis ability of engineering bacteria need be improved in this area, and said engineering bacteria can the outer free fatty acids of high yield born of the same parents.

Summary of the invention

The invention provides a kind of method that improves engineering bacteria lipid acid exocytosis ability; Promptly through genetically engineered and metabolic regulation technology; Coexpression plant sulfolipid enzyme gene, intestinal bacteria thioester enzyme gene and inner membrance lipid Flippases gene in engineering bacteria; The transhipment of regulation and control engineering bacteria lipid acid makes the engineering bacteria can the high yield free fatty acids, improves lipid acid exocytosis ability.The application in improving free fatty acids exocytosis ability of said coexpression enzyme gene system, engineering bacteria and metabolic regulation approach; Said engineering bacteria is used to produce outer free fatty acids of born of the same parents or derivative of fatty acid, like Fatty Alcohol(C12-C14 and C12-C18), aliphatic hydrocarbon etc.

A kind of method that improves engineering bacteria lipid acid exocytosis ability; The a series of enzyme genes that comprise coexpression regulation and control fatty acid metabolism; Wherein, said co-expression gene comprises plant sulfolipid enzyme (AtFatA), intestinal bacteria thioester enzyme (tesA) and inner membrance lipid Flippases (msbA);

A kind of ability hydrolysis acyl-ACP (acyl carrier protein (ACP); Acyl Carrier protein; ACP), discharge free fatty acids, improve plant sulfolipid enzyme (AtFatA) gene of engineering bacteria lipid acid exocytosis ability; Can derive from the AtFatA gene of Arabidopsis thaliana; Also can derive from the PtFATB gene of Arabidopsis thaliana, or derive from the BTE gene of Umbellularia californica, or same AtFatA, PtFATB, BTE dna homolog property surpass 65% plant sulfolipid enzymatic nucleic acid sequence;

A kind of thioester enzyme gene that can acyl-CoA hydrolysis be discharged the outer free fatty acid content of raising engineering mycetocyte of free fatty acids comprises the tesA gene of Escherichia coli, or surpasses 65% dna sequence dna with tesA dna homolog property.

A kind of method that improves engineering bacteria lipid acid exocytosis ability comprises the inner membrance lipid Flippases gene that improves the Bacillus coli cells membrane permeability, derives from the msbA gene of Escherichia coli, or surpasses 65% dna sequence dna with msbA dna homolog property.

Said regulation and control lipid acid exocytosis ability genes involved, the endogenous or allogenic thioester enzyme of coexpression and inner membrance Flippases gene can also can be expressed in other prokaryotic organism, as acinetobacter calcoaceticus, subtilis etc. at expression in escherichia coli.

The lipid acid that described engineering bacteria metabolism is produced, the application in chemistry painting industry, printing and dyeing, emulsifying agent, tensio-active agent, makeup, food, Medicines and Health Product; Contain derivative of fatty acid Fatty Alcohol(C12-C14 and C12-C18) that said engineering bacteria produces, aliphatic hydrocarbon etc.

Compare with known technology, the present invention has the following advantages:

Among the present invention in engineering bacteria coexpression plant sulfolipid enzyme (AtFatA), intestinal bacteria thioester enzyme (tesA) and inner membrance lipid Flippases (msbA); Improve engineering bacteria lipid acid exocytosis ability; The outer free fatty acid content of born of the same parents is 120mg/L; Compare with the original intestinal bacteria of the endogenous or heterologous gene of not regulating and control lipid acid transhipment relevant enzyme, the outer free fatty acid content of born of the same parents has improved 10 times (original strain is 10.5mg/L); Compare with the engineering bacteria of only expressing plant sulfolipid enzyme (AtFatA) or intestinal bacteria thioester enzyme (tesA), the outer free fatty acid content of engineering mycetocyte has improved about 5 times, (single expression thioester enzyme gene fatty acid content is about 25mg/L); And outer free fatty acids composition of born of the same parents and petrochemical industry oil phase are seemingly.

Adopt this bacterial strain to produce lipid acid, solved the problem of extraction separation complicacy during lipid acid is produced, grease production cost height, serious environment pollution, can directly be used for industrial production, more help the development of high-quality, low-cost lipid acid.The lipid acid that this method is produced also can be used for the production of derivative of fatty acid such as Fatty Alcohol(C12-C14 and C12-C18), alkanoic, aliphatic hydrocarbon.

More specifically, the present invention provides and the following:

1. the method for the ability of an exocytosis free fatty acids that improves mikrobe is included in and crosses expression external source or endogenous inner membrance lipid Flippases gene in the said mikrobe.

2. method according to claim 1 is wherein also crossed simultaneously in said mikrobe and is expressed one or more external sources or endogenous thioester enzyme gene.

3. method according to claim 1; Wherein said mikrobe is a prokaryotic micro-organisms, is preferably selected from intestinal bacteria (Escherichia coli), acinetobacter calcoaceticus (Acinetobacter calcoaceticus) and subtilis (Bacillus subtilis).

4. method according to claim 1; Wherein said inner membrance lipid Flippases gene is selected from: 1) colibacillary msbA gene; Or 2) have the dna sequence dna that surpasses 65% homology with the msbA gene, the sequence of preferred intestinal bacteria msbA gene is shown in SEQ ID NO.3.

5. method according to claim 2, wherein said thioester enzyme gene are selected from plant sulfolipid enzyme gene and bacterium thioester enzyme gene, and the sequence of preferred intestinal bacteria thioester enzyme gene tesA is shown in SEQ ID NO.2.

6. method according to claim 5, wherein said plant sulfolipid enzyme gene is selected from:

1) the AtFatA gene of Arabidopis thaliana (Arabidopsis thaliana), preferred Arabidopis thaliana thioester enzyme Gene A tFatA sequence is shown in SEQ ID NO.1;

2) the PtFATB gene of Arabidopis thaliana (Arabidopsis thaliana);

3) the BTE gene of California cassia tree (Umbellularia californica); Or

4) has the nucleotide sequence of the coded plant thioesterase that surpasses 65% homology with AtFatA, PtFATB or BTE gene.

7. method according to claim 5, wherein bacterium thioester enzyme gene is selected from: 1) colibacillary tesA gene, or 2) have the dna sequence dna that surpasses 65% homology with the tesA gene.

8. according to each described method among the claim 1-7, wherein coexpression inner membrance lipid Flippases gene (preferred intestinal bacteria inner membrance lipid Flippases gene), plant sulfolipid enzyme gene and intestinal bacteria thioester enzyme gene in mikrobe.

9. free fatty acids and/or the derivative of fatty acid produced through each described method among the claim 1-8 are like Fatty Alcohol(C12-C14 and C12-C18), aliphatic hydrocarbon etc.

Description of drawings

Fig. 1. ((1) acetyl-CoA carboxylase (ACC): the catalysis acetyl-coa carboxylase generates malonyl CoA to the fatty acid metabolism figure in the intestinal bacteria; (2) Triphosphopyridine nucleotide, reduced (NADPH): the decarboxylation of catalysis oxysuccinic acid provides reducing power NADPH for lipid acid is synthetic; (3) acetyl-CoA synthase (ACS): catalysis acetate is to the reaction of acetyl-CoA; (4) acyl CoA synthase (FAS): the catalysis malonyl CoA is to the reaction of lipid acid; (5) thioester enzyme tesA: catalysis long-chain acyl ACP degraded, the key gene of release free fatty acids);

Fig. 2. the structure synoptic diagram of Arabidopis thaliana thioester enzyme (AtFatA), intestinal bacteria thioester enzyme (tesA) and inner membrance lipid Flippases (msbA) expression vector pMX36;

Fig. 3. Arabidopis thaliana thioester enzyme Gene A tFatA sequence;

Fig. 4. the sequence of intestinal bacteria thioester enzyme gene tesA;

Fig. 5. the sequence of intestinal bacteria msbA gene;

The SDS-PAGE that Fig. 6 .pMX36 expresses in E.coli analyzes (swimming lane M, LMWP standard substance; Swimming lane 1: not with IPTG inductive reorganization bacterium MX36; Swimming lane 2 and swimming lane 3: with IPTG inductive reorganization bacterium MX36); With

Fig. 7 .GC-MS analyzes lipid acid and forms.

Embodiment

With the engineering colon bacillus is example, and specific embodiment is following:

Embodiment 1:

Through overexpression plant sulfolipid enzyme Gene A tFatA in intestinal bacteria, intestinal bacteria thioester enzyme gene tesA, intestinal bacteria inner membrance lipid Flippases gene msbA, make up the recombinant bacterial strain of efficient secretion free fatty acids, in order to produce the free-fat acid fuel.

The clone of 1 goal gene

1.1 the clone of Arabidopis thaliana thioester enzyme Gene A tFatA

Extract total mRNA of Arabidopsis thaliana; Reverse transcription is cDNA (adopting Shanghai to give birth to worker's UNIQ-10 pillar Trizon total RNA extraction reagent box and the operation of Revert Aid First strand cDNA Synthesis Kit reverse transcription test kit) then; According to GenBank Accession No.Z36912 design primer; Pcr amplification clone's thioester enzyme Gene A tFatA utilizes the Fermentas gel to reclaim test kit again and reclaims goal gene.

The Arabidopis thaliana thioester enzyme Gene A tFatA sequence of amplification is shown in Fig. 3 and SEQ ID NO.1.

The above-mentioned sequences Design primer sequence of reference is (the line part is a restriction enzyme site) as follows:

Upstream primer th-L:CATG CCATGGTTTTGAAGCTTTCGTGTAATGTGAC,

Downstream primer th-R1:CGC GGATCCTTAACTTGAAGGCTTCTTTCTCCAC.

1.2 the clone of intestinal bacteria thioester enzyme gene

(the SDS-CATB combined techniques extracts bacterial genomes DNA to extract E.coli K12 (NRRL B-3707) genomic dna; Concrete operation method reference molecule cloning experimentation guide (third edition)); According to GenBank Accession No.CP000948 design primer; Pcr amplification tesA gene, blended rubber reclaims test kit and reclaims target gene fragment.

The sequence of intestinal bacteria thioester enzyme gene tesA is shown in Fig. 4 and SEQ ID NO.2.

The above-mentioned sequences Design primer sequence of reference is (the line part is a restriction enzyme site) as follows:

Upstream primer tesA-L:CCG GAATTCATGAACTTCAACAATGTTTTCC,

Downstream primer tesA-R ': ACGC GTCGACTTATGAGTCATGATTTACTAAAGGC

1.3 the clone of intestinal bacteria inner membrance lipid Flippases gene

Extract E.coli K12 genomic dna, according to GenBank sequence A ccession No.U00096 design primer, pcr amplification msbA gene, blended rubber reclaims test kit and reclaims target gene fragment.

The sequence of intestinal bacteria msbA gene is shown in Fig. 5 and SEQ ID NO.3.

The above-mentioned sequences Design primer sequence of reference is (the line part is a restriction enzyme site) as follows:

Upstream primer msbA-L:CGC GGATCCATGCATAACGACAAAGATCTCTCTACG,

Downstream primer msbA-R:AATCGC GAGCTCTCATTGGCCAAACTGCATTTTG.

2 recombinant plasmid pMX36 make up

2.1 AtFatA gene and tesA gene integration

All use NcoI and BamH I to carry out double digestion in AtFatA gene and pET-30a (+) carrier (Novagen) after the glue recovery; Carrier and exogenous segment in molar ratio 1: 1-1: 10 ratio; Add T4DNA ligase enzyme (Fermentas company); 37 ℃ connect 2-16h, connect product and adopt the thermal shock method to be converted in E.coli BL21 (DE3) competent cell (Transgene company).Random choose list bacterium colony, bacterium liquid PCR screening positive clone extracts recombinant plasmid, identifies through restriction enzyme digestion and order-checking again, is the recombinant plasmid pYJM1 of structure.The intestinal bacteria E.coli BL21 (DE3) that contains recombinant plasmid pYJM1 is called YJM1.Use the tesA gene fragment after identical restriction enzyme (NcoI/SalI) enzyme is cut recombinant plasmid pYJM1 and glue recovery test kit purifying again; And according to 1: 1-1: 10 ratios connect; Equally; The connection product adopts the thermal shock method to be converted in E.coli BL21 (DE3) competent cell, cuts through bacterium liquid PCR evaluation, enzyme and identifies and the order-checking evaluation, is the recombinant plasmid pMX25 that integrates AtFatA gene and tesA gene.

2.2 AtFatA gene, tesA gene and msbA gene integration

The msbA gene that the recombinant plasmid pMX25 and the glue of the above-mentioned AtFatA of integration gene and tesA gene is reclaimed purifying with cut with identical restriction enzyme (NcoI/SalI) enzyme; Carrier and exogenous segment in molar ratio 1: 1-1: 10 ratio; 37 ℃ connect 2-16h; Connect product thermal shock method and be converted in E.coli BL21 (DE3) competent cell, make up recombinant bacterial strain MX36.Random choose list bacterium colony, bacterium liquid PCR screening positive clone behind the extraction recombinant plasmid, is identified through restriction enzyme digestion and order-checking from positive colony again, is the recombinant plasmid pMX36 (plasmid map is seen Fig. 2) of integration AtFatA gene, tesA gene and msbA gene.

2.3 induction expression of protein and purifying

The engineering bacteria that builds is seeded to 5mL by 1% inoculum size contains 50 μ gmL ^-1In the LB liquid medium of Kan, 37 ℃, the about 2-2.5h of 200-220rpm shaking culture works as OD ₆₀₀When being about 0.4-0.6, add inductor IPTG to final concentration 1mM, 37 ℃ of shaking culture 3-5h, abduction delivering target protein.Culture after taking-up is induced, 12, the centrifugal 2min of 000g; Collect thalline, somatic cells washs once with the phosphate buffered saline buffer (pH 7.8) of 0.05M, uses this damping fluid re-suspended cell again in 1: 10 ratio; Add equal-volume 2 * SDS-PAGE sample-loading buffer, boil 5min, instantaneous high speed centrifugation; The 10%SDS-PAGE electrophoresis detection can detect the expression (see figure 6) of target protein, and through Ni affinity chromatography column purification target protein.

Embodiment 2:

With the engineering strain MX36 fermentative prodn lipid acid that builds, its step is following:

1) strain culturing: with engineering bacteria MX36 by volume 1% inoculum size be inoculated into 100mL and contain 50 μ gmL ^-1In the LB liquid medium of kantlex, at 37 ℃, shaking culture is to OD under the condition of 225rpm ₆₀₀Be about 0.6, add inductor IPTG to final concentration 0.1mM, 30 ℃ are continued to cultivate 18-24h;

2) lipid acid extracts: centrifugal collection supernatant, with extractant (chloroform/normal heptane/methyl alcohol, 56: 42: 2; V/v) according to volumetric ratio extraction in 1: 1, extract three times, collect extraction liquid; Rotary evaporation, organic solvent is removed in volatilization, is the lipid acid bullion that extracts;

3) directly add 2mL methyl esterification reagent (boron trifluoride/methyl alcohol: 1/4) in lipid acid bullion methyl esterification of fatty acid: to step 2); Place 60 ℃ of water-baths to react 0.5h; Adopt 2mL n-hexane extraction fatty acid methyl ester; Underpressure distillation concentrates, obtain fatty acid bullion (mixture of multiple fatty acid methyl ester);

4) fatty acid content is measured: measure lipid acid composition and the content that the reorganization bacterium produces through GC-MS.The GC-MS detection method: get the sample after the 1 μ l esterification, GC-MS detects reorganization bacterium lipid acid and forms.Chromatographic condition is following: TR-Wax MS GC capillary chromatographic column (30m, 0.25mm, 0.25 μ m, U.S. Agilent 6897), and carrier gas: high pure nitrogen (99.999%), the sampler temperature: 250 ℃, detector temperature: 300 ℃, the carrier gas column cap is pressed: 10psi; Temperature programming: initial 100 ℃, continue 2min, 100 ℃/min is warming up to 250 ℃, keeps 5min.With C20:0 is that standard substance carry out quantitatively.

5) the GC-MS spectrogram is as shown in Figure 7.

6) the lipid acid calculation formula is following, and experimental result is seen table 1 and table 2.

M _FA＝(V _FA/V _S)·MS

M _FA: lipid acid quality (mg);

V _FA: each fatty acid component peak area sum of sample;

V _S: the standard substance peak area;

MS: standard substance quality (mg).

Table 1 free fatty acids rate ratio

Strain number	Free-fat acid yield (mg/L)	Bacterial strain is described
			?BL21(DE3)	5.21±0.82	Original bacterium
?YJM1	33.53±6.92	Only express AtFatA
			?MX33	25.23±9.12	Only express tesA
?MX36	120.8	Coexpression AtFatA, tesA and msbA

The building process of bacterial strain MX33 is following:

(1) pcr amplification purpose fragment

(the SDS-CATB combined techniques extracts bacterial genomes DNA to extract E.coli K12 (NRRL B-3707) genomic dna; Concrete operation method reference molecule cloning experimentation guide (third edition)); According to GenBank Accession No.CP000948 design primer; Pcr amplification tesA gene, blended rubber reclaims test kit and reclaims target gene fragment.

The sequence of intestinal bacteria thioester enzyme gene tesA is shown in Fig. 4 and SEQ ID NO.2.

The above-mentioned sequences Design primer sequence of reference is (the line part is a restriction enzyme site) as follows:

Upstream primer tesA-L:CCGGAATTCATGAACTTCAACAATGTTTTCC,

Downstream primer tesA-R ': ACGCGTCGACTTATGAGTCATGATTTACTAAAGGC

(2) construction of recombinant plasmid

The PCR product of purifying is cut with restriction enzyme EcoRI/SalI enzyme, be connected, be converted in the e. coli bl21 (DE3) with expression vector pET30 after cutting with the same enzyme enzyme.Through bacterium colony PCR primary dcreening operation, cut evaluation through PCR evaluation and enzyme again, the result is in full accord, obtains the single purpose band, obtains positive reorganization bacterium, proves the construction of recombinant plasmid success.Picking 2-4 positive reorganization bacterium order-checking at random, the result shows that the purpose fragment successfully is inserted on the corresponding site of expression vector, and does not undergo mutation in the building process, has promptly obtained reorganization bacterium MX33.

The composition of the lipid acid that table 2 MX36 produces

Form	C16:0	C16:1	C14:0	C18:1
					Content (mg/L)	55.8	18.4	11.8	25.2

Embodiment 3:

With the engineering strain MX36 fermentative prodn lipid acid that builds, its step is following:

1) with engineering bacteria MX36 by volume 1% inoculum size be inoculated into 100mL and contain 50 μ gmL ^-1In the LB liquid medium of kantlex, at 37 ℃, shaking culture is to OD under the condition of 225rpm ₆₀₀Be about 0.6, add inductor IPTG to final concentration 0.1-1mM, adding substrate sodium malate (adding purpose: the auxilliary substrate of reaction promotes the performance of malic enzyme function) to final concentration simultaneously is 15mM, continues to cultivate 18-24h;

2) centrifugal collection supernatant, with extractant (chloroform/normal heptane/methyl alcohol, 56: 42: 2, v/v), extract three times according to the extraction of 1: 1 volumetric ratio, collect extraction liquid, rotary evaporation volatilizees and removes organic solvent, is the lipid acid bullion that extracts;

3) to step 2) the lipid acid bullion in directly add the 2mL methyl esterification reagent, place 60 ℃ of water-baths to react 0.5h, adopt 2mL n-hexane extraction fatty acid methyl ester, underpressure distillation concentrates, the obtain fatty acid bullion;

4) measure reorganization bacterium lipid acid output through GC-MS, the lipid acid calculation formula is with embodiment 2.

The fermentation culture result of embodiment 3 is as shown in table 3:

Table 3 ferment tank reorganization bacterium MX36

Reference

1.Steen?JE，Kang?Y，Bokinsky?G，Hu?Z，Schirmer?A，McClure?A，Cardayre?SB，Keasling?JD.Microbial?production?of?fatty-acid-derived?fuels?and?chemicals?from?plant?biomass.Nature，2010，463：559-562.

2.Nunn?WD，Colburn?RW，Black?PN.Transport?of?Long-chain?Fatty?Acids?in?Escherichia?coli.J?Biol?Chem，1986，261：167-171.

3.Kampf?JP，Cupp?D，Kleinfeld?AM.Different?mechanisms?of?free?fatty?acid?flip-flop?and?dissociation?revealed?by?temperature?and?molecular?species?dependence?of?transport?across?lipid?vesicle.J?Biol?Chem，2006，281：21566-21574.

4.Carley?AN，Kleinfeld?AM.Flip-Flop?is?the?rate-limiting?step?for?transport?of?free?fatty?acids?across?lipid?vesicle?membranes.Biochemistry，2009，48：10437-10445.

5.Reyes?CL，Chang?G.Structure?of?the?ABC?transporter?MsbA?in?complex?with?ADP·vanadate?and?lipopolysaccharide.Science，2005，308：1028-31.

6.Wu?T，McCandlish?AC，Gronenberg?LS，Chng?SS，Silhavy?TJ，Kahne?D.Identification?of?a?protein?complex?that?assembles?lipopolysaccharide?in?the?outer?membrane?of?Escherichia?coli.Proc?Natl?Acad?Sci，2006，103：11754-11759.

7.Chisti?Y.Biodiesel?from?microalgae.Biotechnology?Advances，2007，25：294-306.

8.Wynn?JP，Hamid?AA，Li?Y，Ratledge?C.Biochemical?events?leading?to?the?diversion?of?carbon?into?storage?lipids?in?the?oleaginous?fungi?Mucor?circinelloides?and?Mortierella?alpina.Microbiology，2001，147：2857-2864.

9.Liu?T，Vora?H，Khosla?C.Quantitative?analysis?and?engineering?of?fatty?acid?biosynthesis?in?E.coli.Metabolic?Engineering，2010.

Claims (9)

1. the method for the ability of an exocytosis free fatty acids that improves mikrobe is included in and crosses expression external source or endogenous inner membrance lipid Flippases gene in the said mikrobe.

2. method according to claim 1 is wherein also crossed simultaneously in said mikrobe and is expressed one or more external sources or endogenous thioester enzyme gene.

3. method according to claim 1; Wherein said mikrobe is a prokaryotic micro-organisms, is preferably selected from intestinal bacteria (Escherichia coli), acinetobacter calcoaceticus (Acinetobacter calcoaceticus) and subtilis (Bacillus subtilis).

4. method according to claim 1; Wherein said inner membrance lipid Flippases gene is selected from: 1) colibacillary msbA gene; Or 2) have the dna sequence dna that surpasses 65% homology with the msbA gene, the sequence of preferred intestinal bacteria msbA gene is shown in SEQ ID NO.3.

5. method according to claim 2, wherein said thioester enzyme gene are selected from plant sulfolipid enzyme gene and bacterium thioester enzyme gene, and the sequence of preferred intestinal bacteria thioester enzyme gene tesA is shown in SEQ ID NO.2.

6. method according to claim 5, wherein said plant sulfolipid enzyme gene is selected from:

1) the AtFatA gene of Arabidopis thaliana (Arabidopsis thaliana), preferred Arabidopis thaliana thioester enzyme Gene A tFatA sequence is shown in SEQ ID NO.1;

2) the PtFATB gene of Arabidopis thaliana (Arabidopsis thaliana);

3) the BTE gene of California cassia tree (Umbellularia californica); Or

4) has the nucleotide sequence of the coded plant thioesterase that surpasses 65% homology with AtFatA, PtFATB or BTE gene.

7. method according to claim 5, wherein bacterium thioester enzyme gene is selected from: 1) colibacillary tesA gene, or 2) have the dna sequence dna that surpasses 65% homology with the tesA gene.

8. according to each described method among the claim 1-7, wherein coexpression inner membrance lipid Flippases gene (preferred intestinal bacteria inner membrance lipid Flippases gene), plant sulfolipid enzyme gene and intestinal bacteria thioester enzyme gene in mikrobe.

9. free fatty acids and/or the derivative of fatty acid produced through each described method among the claim 1-8 are like Fatty Alcohol(C12-C14 and C12-C18), aliphatic hydrocarbon etc.

Images